| Ineffective siRNAs | ||||||||
| ID | gene name | accession number | start codon position | termi- nating codon position |
target site position | length of mRNA | target site | length of siRNA |
| 1 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 75 | 2104 | CATGGAGACCCCTGCCTGGCCCC | 21 |
| 2 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 156 | 2104 | CCAGGTGGCCGGCGCTTCAGGCA | 21 |
| 3 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 159 | 2104 | GGTGGCCGGCGCTTCAGGCACTA | 21 |
| 4 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 162 | 2104 | GGCCGGCGCTTCAGGCACTACAA | 21 |
| 5 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 168 | 2104 | CGCTTCAGGCACTACAAATACTG | 21 |
| 6 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 171 | 2104 | TTCAGGCACTACAAATACTGTGG | 21 |
| 7 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 174 | 2104 | AGGCACTACAAATACTGTGGCAG | 21 |
| 8 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 254 | 2104 | AACCCGTCAATCAAGTCTACACT | 21 |
| 9 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 457 | 2104 | AACTCCCCAGAGTTCACACCTTA | 21 |
| 10 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 476 | 2104 | CTTACCTGGAGACAAACCTCGGA | 21 |
| 11 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 560 | 2104 | AACGGACTTTAGTCAGAAGGAAC | 21 |
| 12 | human Tissue Factor (hTF) | M16553.1 | 76 | 963 | 927 | 2104 | GAGCTGGAAGGAGAACTCCCCAC | 21 |
| 13 | human protein serine kinase H1 (PSKH1) | AJ272212.1 | 131 | 1405 | 312 | 3460 | CCTGCCCCGGTCCCCCGACTGCT | 21 |
| 14 | human protein serine kinase H1 (PSKH1) | AJ272212.1 | 131 | 1405 | 544 | 3460 | GGTGTGTGAGTCGGAGCTGCGTG | 21 |
| 15 | human protein serine kinase H1 (PSKH1) | AJ272212.1 | 131 | 1405 | 564 | 3460 | GTGTGCTGCGTCGGGTGCGTCAT | 21 |
| 16 | human protein serine kinase H1 (PSKH1) | AJ272212.1 | 131 | 1405 | 737 | 3460 | CTGGATGGCGTCCGGTATCTGCA | 21 |
| 17 | human protein serine kinase H1 (PSKH1) | AJ272212.1 | 131 | 1405 | 130 | 3460 | GATGGGCTGTGGGACAAGCAAGG | 21 |
| 18 | human protein serine kinase H1 (PSKH1) | AJ272212.1 | 131 | 1405 | 1382 | 3460 | TACCAGCAGCAATACAATGGCTG | 21 |
| Remarks: All ineffective siRNAs are from the paper: Holen T, Amarzguioui M, Wiige, MT, Babaie E, and Prydz H. (2002). Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucl. Acids Res. 30(8):1757-1766 | ||||||||